-->
 

Home

Dec 12, 2009

ATG:Newsletter 100120


Synthetic Genes and ACEMBL -Assembly Cloning for Multi-Protein Expression

  • Gene Clusters of Protein Complexes of Eukaryotes and
  • Artificial Biochemical Pathways
  • Easy Modular Shuttle Vector Design
are waiting to be explored and developed:


ACEMBL_IC for Insect Cells and ACEMBL-EC are available… here


Please inquire for:

evoMAG - Expression Optimization by in silico Gene Evolution … here
and our Cloning Servicehere

NEWS:

…---pET17b-XbaI-5'-UTR-rbs-NdeI-ATG-CDS-MB1N1C-CDS-TAA-tEcoRI-
pET17b---…… taatGAATTC

tc taga aataattttgtttaactttaaga aggaga tata cat a tg GATCCGCCGCGCGCGAGCCATCT
GAGCCCGCGCAAA AAACGCCCGCGCCAGACCGGCGCGCTGATGGCGAGCAGCCCGCAGGATATTAAAT

Figure 1. Most recent publications1,2 are confirming the observation the 5'-leader sequence (indicated in green) is playing an important role in the transcriptional initiation by interacting with the 5'-end of the coding sequence in individual genes. This individuality of the coding sequence forming an individual determinant of the different genes is the main reason for the necessity adapting genes by inclusion of the 5'-trailer sequence1. In our example the constant Phage T7 trailer sequence T7_transl_en_RBS is available for example in pET17b. This trailer is good for a variety of genes but by far not for all. Please remember the initiation rate is the rate limiting step in translational processes in case it is lower than the elongation rate. But in case the average elongation rate is higher than the translational initiation rate other rules are becoming effective influencing parameters like polysomal package2 with impact on mRNA-stability, suppression of inclusion bodies increase of the specific activity of the products and improvement of the general translationability of the genes optimized in this respect.

1 Salis et al. (2009) Automated design of synthetic ribosome binding sites to control protein expression,Nature Biotechnology 27:946-950.
2 Brandt et al. (2009) The native 3D organization of bacterial polysomes. Cell 136:261-271.

Company News

ATG's website has moved.....

Page 1 of 54 > >>


May 7, 2013
Posted by: ATG_Member

PepID bio-based Peptide Libraries:

Calendar

IASB

ATG supports the IASB in establishing and promoting a safe and secure synthetic biotechnology industry to improve the quality of life for everyone.
 
::: Made with CoffeeCup : Web Design Software & Website Hosting :::